However, the mechanism behind how these proteins bind at similar locations of mRNA is yet to be found. remains unclear. To address such a challenge, we used primary hippocampal neurons cultured in chemically oxygenCglucose deprived (cOGD) conditions and a transient cerebral ischemia model mouse induced by transient middle cerebral artery occlusion (tMCAO) as a model for in vivo neurodegeneration and investigated the regulatory mechanism behind the expression of (Primers: forward: ACGCGTCGACGCCGGAAGGCCGCCCCG; reverse: TCCCCCCGGGGTTTCCGGAAACGAAAGGGAGAC) was cloned into the pRF bicistronic vector that contains coding sequences of renilla luciferase (Rluc) and firefly luciferase (Fluc). Plasmids with the deletion of the D1 region of 5UTR (pRF D1) were also generated similarly. These plasmids were used to measure the translational activity of 5UTR. The Rluc and Fluc coding sequences of pRF vectors were then replaced with coding sequences of mCherry and eGFP fluorescent protein with a myristoylation signal to measure the translational activity of 5UTR in the primary hippocampal neuron. 5UTR of Cfl1 mRNA was also cloned into pSK vectors for in vitro transcription. 2.3. RNA Interference N2a cells were transfected with small interfering RNAs (siRNAs) or short hairpin RNAs (shRNA) by electroporation using NEON? transfection system (Invitrogen, Waltham, MA, USA) or by Lipofectamine 2000 (Invitrogen) according to the manufacturers instruction. The siRNAs that were used in this study are as follows: si-control (Bioneer; 5-CCUACGCCACCAAUUUCGU-3), si-hnRNP Q (Bioneer; 5-AGACAGUGAUCUCUCUCAUTT-3), si-hnRNP Q1 (Bioneer; 5-GAUCAGAAGAGGAAAGAAATT-3), si-hnRNP A1 (Bioneer; 5-GGACUGUAUUUGUGACUAA-3), and si-nPTB, which was bought from Dharmacon (siGENOME SMARTpool Mouse Ptbp2 siRNA; M-049626). The siRNA sequences of hnRNP Q1 and hnRNP A1 were used to generate shRNA. Rabbit Polyclonal to RNF111 The oligonucleotides of hnRNP Q1 and hnRNP A1 were annealed and inserted into pLentiLox3.7 (pLL3.7) lentiviral plasmid. 2.4. SDS-Polyacrylamide Gell Electrophoresis (PAGE) and Immunoblotting A total of 20 or 30 g of cell lysates (protein in cell lysates) were mixed with 5 sample buffer (0.6% 1M Tris, 50% Glycerol, 10% SDS, 0.5% PRT 062070 (Cerdulatinib) 2-Mercaptoethanol, and 1% Bromophenol blue) to create loading samples. The samples were loaded onto the Western blot gel and were resolved in electrophoresis chambers (Bio-Rad, Hercules, CA, USA). Then, the proteins in the gel were transferred to nitrocellulose membranes (Pall Corporation, NY, USA) using the same power supply and transfer chamber (Bio-Rad). For immunoblotting, the membranes were incubated with the primary antibodies for 12 h at 4 C followed by secondary antibody for 2 h at room temperature. The membranes were visualized with PRT 062070 (Cerdulatinib) the LAS-4000 system (FUJIFILM, Tokyo, Japan) after treating the membrane with enhanced chemiluminescent (ECL) solution. 2.5. RNA Extraction and RT-qPCR The RNA from harvested cells or brain tissues were extracted using TRI reagent according to the manufacturers instructions. Briefly, the cell or brain tissues were homogenized in the TRI reagent before adding chloroform totaling 1/5th of the original volume. Then, the samples were incubated at room temperature for 10 min before centrifugation at 15,000 rpm, at 4 C, for 10 min. Then, the supernatant of the samples was moved to a PRT 062070 (Cerdulatinib) fresh e-tube, and an equal volume of isopropanol was added to the sample. After incubating the samples in ice for 10 min, the samples were centrifuged at 15,000 rpm, at 4 C, for 10 min. After removing isopropanol from the samples, RNA pellets were washed in ethanol and dissolved in DEPC-treated water. Isolated RNAs from the cell or brain tissue were reverse-transcribed with Improm-II reverse transcription system from Promega following the providers instructions. The cDNA from RT-PCR was used to measure the RNA level of cells or brain tissue. FastStart Universal SYBR Green Master from Roche was used for the reaction while StepOnePlus Real-Time system was used to measure the level. Different primers of the target genes were used as follows: (mouse), 5-GCCAACTTCTAACCACAATAG-3 and 5-CCTTACTGGTCCTGCTTCC-3; (mouse), 5-AAATGGTGAAGGTCGGTGTG-3 and 5-TGAAGGGGTCGTTGATGG-3; (mouse), 5-AACCCAGAGGCATTGACAAC-3 and 5-CACCTCCAGCTCCTTGACAT-3; (mouse), 5-CAGCCTTCCACCTTATGCTC-3 and 5-TTGCTGCTGCTGTCTTTGTT-3; (mouse), 5-CTGTCGAAGCAAGAGATGGC-3 and 5-GCCTCCTCCATAACCACCAT-3; (mouse), 5-ACCACCTCCAGATTCCGTTT-3 and 5-GCCTCTTGTGCTGCTTCTTT-3; (mouse), 5-CTATGGAGGCCAGAAGAGGGTAT-3, and 5-CCCACATCAGGTGGCTCATAA-3. 2.6. Luciferase Assay Neuro2a cells were co-transfected with pRF vectors and siRNAs and harvested 24 h after transfection. Cells were lysed with the reporter lysis buffer (Promega, Madison, WI, USA), incubated in ice for 10 min and centrifuged at 15,000 rpm, at 4 C, for 10 min before measuring the activity of luciferase of renilla or firefly. The luciferase activity was measured using Dual-Luciferase.
However, the mechanism behind how these proteins bind at similar locations of mRNA is yet to be found
